FASTA format for nucleic acid sequences in Mitomaster

A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol at the beginning. For readability, you may hard-wrap sequences into multiple lines, although a fixed or uniform width (e.g. 80 characters) is not required for Mitomaster.

An example sequence in FASTA format is:
>NC_012920.1 Homo sapiens mitochondrion, complete genome
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGG
GTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTC
CTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTA
ATTAATTAATGCTTGTAGGACATAATAATAACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATC
ATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA
AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCAC
TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATA
CAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAA

Empty lines are not officially allowed in the middle of FASTA input, but Mitomaster will ignore them.

The nucleic acid codes supported in Mitomaster are listed below. Degenerate codes (Y, R, H, etc.) are allowed in generic FASTA format, but are ignored by the current Mitomaster analysis tools and are treated as "N". Lower-case letters are accepted and are mapped into upper-case.
      A  adenosine          C  cytidine         N  A/G/C/T any (will be treated as a deletion)    
      T  thymidine          G  guanine          -  gap of indeterminate length (will be treated as N)
Topic revision: r3 - 24 Feb 2017, MarieLott

POLG Server
MitoScape

This site is powered by FoswikiCopyright © by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding Foswiki? Send feedback